Author: Bill Mesler
Publisher: W. W. Norton & Company
ISBN: 0393248542
Category : Science
Languages : en
Pages : 288
Book Description
The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.
A Brief History of Creation: Science and the Search for the Origin of Life
Author: Bill Mesler
Publisher: W. W. Norton & Company
ISBN: 0393248542
Category : Science
Languages : en
Pages : 288
Book Description
The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.
Publisher: W. W. Norton & Company
ISBN: 0393248542
Category : Science
Languages : en
Pages : 288
Book Description
The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.
Creation
Author: Adam Rutherford
Publisher: Penguin
ISBN: 1101622628
Category : Science
Languages : en
Pages : 288
Book Description
What is life? Humans have been asking this question for thousands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.
Publisher: Penguin
ISBN: 1101622628
Category : Science
Languages : en
Pages : 288
Book Description
What is life? Humans have been asking this question for thousands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.
Origins
Author: Jim Baggott
Publisher: Oxford University Press
ISBN: 0192561960
Category : Science
Languages : en
Pages : 432
Book Description
What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.
Publisher: Oxford University Press
ISBN: 0192561960
Category : Science
Languages : en
Pages : 432
Book Description
What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.
Origins
Author: Robert Shapiro
Publisher:
ISBN:
Category : Life
Languages : en
Pages : 332
Book Description
Publisher:
ISBN:
Category : Life
Languages : en
Pages : 332
Book Description
Creation
Author: Adam Rutherford
Publisher: Penguin
ISBN: 1617230111
Category : Science
Languages : en
Pages : 291
Book Description
Today’s scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge “synthetic biology” may lead to solutions to some of the world’s most pressing crises and pave the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.
Publisher: Penguin
ISBN: 1617230111
Category : Science
Languages : en
Pages : 291
Book Description
Today’s scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge “synthetic biology” may lead to solutions to some of the world’s most pressing crises and pave the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.
Creation
Author: Adam Rutherford
Publisher: Penguin UK
ISBN: 0141970227
Category : Science
Languages : en
Pages : 272
Book Description
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Publisher: Penguin UK
ISBN: 0141970227
Category : Science
Languages : en
Pages : 272
Book Description
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Undeniable
Author: Bill Nye
Publisher: Macmillan
ISBN: 1250007135
Category : Science
Languages : en
Pages : 320
Book Description
Revealing the mechanics of evolutionary theory, the scientist, engineer and inventor presents a compelling argument for the scientific unviability of creationism and insists that creationism's place in the science classroom is harmful not only to our children, but to the future of the greater world as well.
Publisher: Macmillan
ISBN: 1250007135
Category : Science
Languages : en
Pages : 320
Book Description
Revealing the mechanics of evolutionary theory, the scientist, engineer and inventor presents a compelling argument for the scientific unviability of creationism and insists that creationism's place in the science classroom is harmful not only to our children, but to the future of the greater world as well.
What is Creation Science?
Author: Henry Morris
Publisher: New Leaf Publishing Group
ISBN: 1614586829
Category : Religion
Languages : en
Pages : 353
Book Description
Explore the truth of science and faith... and what it means to you! Uncover evidences of Creation in living systems Unravel the questions of Creation and the laws of science Understand the vanishing case for evolution science Many Christians are not aware that many legitimate scientists embrace the Genesis explanation of origins. In What is Creation Science?, two of the most respected members of that group have given us the benefit of their knowledge. The book itself, though technical in places, is remarkably clear, and its focus is on a fair dialogue of the issues. So much so that many thousands of readers have taken to heart Dr. Parker's challenge, to "Think About It!" The creation/evolution question is not an issue that concerns only biologists on the one hand and religious people on the other. In one way or another, the issue permeates every field of academic study and every aspect of national life. It deals with two opposing basic worldviews - two philosophies of origins and destinies, of life and meaning. Consequently, it is (or should be) of special concern to everyone.
Publisher: New Leaf Publishing Group
ISBN: 1614586829
Category : Religion
Languages : en
Pages : 353
Book Description
Explore the truth of science and faith... and what it means to you! Uncover evidences of Creation in living systems Unravel the questions of Creation and the laws of science Understand the vanishing case for evolution science Many Christians are not aware that many legitimate scientists embrace the Genesis explanation of origins. In What is Creation Science?, two of the most respected members of that group have given us the benefit of their knowledge. The book itself, though technical in places, is remarkably clear, and its focus is on a fair dialogue of the issues. So much so that many thousands of readers have taken to heart Dr. Parker's challenge, to "Think About It!" The creation/evolution question is not an issue that concerns only biologists on the one hand and religious people on the other. In one way or another, the issue permeates every field of academic study and every aspect of national life. It deals with two opposing basic worldviews - two philosophies of origins and destinies, of life and meaning. Consequently, it is (or should be) of special concern to everyone.
Science and Creationism
Author: National Academy of Sciences (U.S.)
Publisher: National Academies Press
ISBN: 9780309064064
Category : Education
Languages : en
Pages : 48
Book Description
This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)
Publisher: National Academies Press
ISBN: 9780309064064
Category : Education
Languages : en
Pages : 48
Book Description
This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)
In Search of the ... Origin of Life
Author: Richard B. Bliss
Publisher:
ISBN: 9780890510537
Category : Life
Languages : en
Pages : 51
Book Description
A textbook which analyzes two theories of the origin of life and presents arguments supporting each one.
Publisher:
ISBN: 9780890510537
Category : Life
Languages : en
Pages : 51
Book Description
A textbook which analyzes two theories of the origin of life and presents arguments supporting each one.